New model in OGS2.0 | DPOGS202888 DPOGS202887  |
---|---|
Genomic Position | scaffold273:- 119609-119851 |
See gene structure | |
CDS Length | 243 |
Paired RNAseq reads   | 56 |
Single RNAseq reads   | 2087 |
Migratory profiles | Query via corresponding ESTs |
Best Bmobyx hit | BGIBMGA004164 (7e-26) |
Best Drosophila hit   | Jun-related antigen, isoform A (1e-17) |
Best Human hit | transcription factor jun-D (6e-16) |
Best NR hit (blastp)   | transcriptional activator of the JUN family [Glossina morsitans morsitans] (7e-28) |
Best NR hit (blastx)   | PREDICTED: similar to GA15338-PA [Nasonia vitripennis] (6e-18) |
GeneOntology terms    | GO:0007465 R7 cell fate commitment GO:0007254 JNK cascade GO:0005634 nucleus GO:0003702 RNA polymerase II transcription factor activity GO:0007391 dorsal closure GO:0008134 transcription factor binding GO:0006357 regulation of transcription from RNA polymerase II promoter GO:0003704 specific RNA polymerase II transcription factor activity GO:0005737 cytoplasm GO:0046844 micropyle formation GO:0046843 dorsal appendage formation GO:0005515 protein binding GO:0000165 MAPKKK cascade GO:0046982 protein heterodimerization activity GO:0007464 R3/R4 cell fate commitment GO:0001736 establishment of planar polarity GO:0043565 sequence-specific DNA binding GO:0006355 regulation of transcription, DNA-dependent GO:0046983 protein dimerization activity GO:0003700 sequence-specific DNA binding transcription factor activity GO:0006911 phagocytosis, engulfment GO:0046529 imaginal disc fusion, thorax closure GO:0008348 negative regulation of antimicrobial humoral response GO:0051124 synaptic growth at neuromuscular junction |
InterPro families    | IPR004827 Basic-leucine zipper (bZIP) transcription factor IPR011616 bZIP transcription factor, bZIP-1 IPR002112 Transcription factor Jun |
Orthology group | MCL11980 |
Nucleotide sequence:
ATGGACACCCAGGAGAGGATCAAACTAGAACGGAAGAGACAGAGGAACCGAGTGGCGGCT
TCCAAATGCAGACGGCGGAAGCTGGAACGCATCTCTAAACTGGAAGAGAAGGTGAAGCTG
TTGAAGGGCGAGAATGTGGAGCTGGCGCAGATGGTGGTGAAGCTGAAGGATCACGTGTCG
CGACTAAAGCAGCAGGTGCTGGAGCACGCCAACAGCGGCTGCCACATCGACACGCACTTC
TGA
Protein sequence:
MDTQERIKLERKRQRNRVAASKCRRRKLERISKLEEKVKLLKGENVELAQMVVKLKDHVS
RLKQQVLEHANSGCHIDTHF