DPGLEAN06357 in OGS1.0

New model in OGS2.0DPOGS202888 DPOGS202887 
Genomic Positionscaffold273:- 119609-119851
See gene structure
CDS Length243
Paired RNAseq reads  56
Single RNAseq reads  2087
Migratory profilesQuery via corresponding ESTs
Best Bmobyx hitBGIBMGA004164 (7e-26)
Best Drosophila hit  Jun-related antigen, isoform A (1e-17)
Best Human hittranscription factor jun-D (6e-16)
Best NR hit (blastp)  transcriptional activator of the JUN family [Glossina morsitans morsitans] (7e-28)
Best NR hit (blastx)  PREDICTED: similar to GA15338-PA [Nasonia vitripennis] (6e-18)
GeneOntology terms






















  
GO:0007465 R7 cell fate commitment
GO:0007254 JNK cascade
GO:0005634 nucleus
GO:0003702 RNA polymerase II transcription factor activity
GO:0007391 dorsal closure
GO:0008134 transcription factor binding
GO:0006357 regulation of transcription from RNA polymerase II promoter
GO:0003704 specific RNA polymerase II transcription factor activity
GO:0005737 cytoplasm
GO:0046844 micropyle formation
GO:0046843 dorsal appendage formation
GO:0005515 protein binding
GO:0000165 MAPKKK cascade
GO:0046982 protein heterodimerization activity
GO:0007464 R3/R4 cell fate commitment
GO:0001736 establishment of planar polarity
GO:0043565 sequence-specific DNA binding
GO:0006355 regulation of transcription, DNA-dependent
GO:0046983 protein dimerization activity
GO:0003700 sequence-specific DNA binding transcription factor activity
GO:0006911 phagocytosis, engulfment
GO:0046529 imaginal disc fusion, thorax closure
GO:0008348 negative regulation of antimicrobial humoral response
GO:0051124 synaptic growth at neuromuscular junction
InterPro families

  
IPR004827 Basic-leucine zipper (bZIP) transcription factor
IPR011616 bZIP transcription factor, bZIP-1
IPR002112 Transcription factor Jun
Orthology groupMCL11980

Nucleotide sequence:

ATGGACACCCAGGAGAGGATCAAACTAGAACGGAAGAGACAGAGGAACCGAGTGGCGGCT
TCCAAATGCAGACGGCGGAAGCTGGAACGCATCTCTAAACTGGAAGAGAAGGTGAAGCTG
TTGAAGGGCGAGAATGTGGAGCTGGCGCAGATGGTGGTGAAGCTGAAGGATCACGTGTCG
CGACTAAAGCAGCAGGTGCTGGAGCACGCCAACAGCGGCTGCCACATCGACACGCACTTC
TGA

Protein sequence:

MDTQERIKLERKRQRNRVAASKCRRRKLERISKLEEKVKLLKGENVELAQMVVKLKDHVS
RLKQQVLEHANSGCHIDTHF