DPGLEAN11249 in OGS1.0

New model in OGS2.0DPOGS207215 
Genomic Positionscaffold425:+ 151083-151244
See gene structure
CDS Length162
Paired RNAseq reads  1
Single RNAseq reads  12
Migratory profilesQuery via corresponding ESTs
Best Bmobyx hitBGIBMGA010709 (3e-23)
Best Drosophila hit  ladybird early (7e-09)
Best Human hitND
Best NR hit (blastp)  PREDICTED: similar to GA19675-PA [Tribolium castaneum] (3e-09)
Best NR hit (blastx)  PREDICTED: similar to GA19675-PA [Tribolium castaneum] (6e-10)
GeneOntology terms
















  
GO:0007483 genital disc morphogenesis
GO:0008544 epidermis development
GO:0045449 regulation of transcription
GO:0005634 nucleus
GO:0006355 regulation of transcription, DNA-dependent
GO:0003700 sequence-specific DNA binding transcription factor activity
GO:0007517 muscle organ development
GO:0007507 heart development
GO:0007417 central nervous system development
GO:0007501 mesodermal cell fate specification
GO:0042659 regulation of cell fate specification
GO:0043565 sequence-specific DNA binding
GO:0045664 regulation of neuron differentiation
GO:0048666 neuron development
GO:0048813 dendrite morphogenesis
GO:0007519 skeletal muscle tissue development
GO:0016477 cell migration
GO:0007520 myoblast fusion
InterPro families  ND
Orthology groupMCL40554

Nucleotide sequence:

ATGGAAGAACTTAAAAAGGACGTCGAGAGCGCCAAGGTGCTGTCGGCGCACAAGAGTTTC
CTCGAGAACGTCACCGACCTGGGCATCCTCAAGAAGAAGGCGATGAGTATAGGCGCCAGC
GAGGAGGCCGCGACCAACCTAGTGGTGAACGCGTCCAAATGA

Protein sequence:

MEELKKDVESAKVLSAHKSFLENVTDLGILKKKAMSIGASEEAATNLVVNASK