New model in OGS2.0 | DPOGS207215  |
---|---|
Genomic Position | scaffold425:+ 151083-151244 |
See gene structure | |
CDS Length | 162 |
Paired RNAseq reads   | 1 |
Single RNAseq reads   | 12 |
Migratory profiles | Query via corresponding ESTs |
Best Bmobyx hit | BGIBMGA010709 (3e-23) |
Best Drosophila hit   | ladybird early (7e-09) |
Best Human hit | ND |
Best NR hit (blastp)   | PREDICTED: similar to GA19675-PA [Tribolium castaneum] (3e-09) |
Best NR hit (blastx)   | PREDICTED: similar to GA19675-PA [Tribolium castaneum] (6e-10) |
GeneOntology terms    | GO:0007483 genital disc morphogenesis GO:0008544 epidermis development GO:0045449 regulation of transcription GO:0005634 nucleus GO:0006355 regulation of transcription, DNA-dependent GO:0003700 sequence-specific DNA binding transcription factor activity GO:0007517 muscle organ development GO:0007507 heart development GO:0007417 central nervous system development GO:0007501 mesodermal cell fate specification GO:0042659 regulation of cell fate specification GO:0043565 sequence-specific DNA binding GO:0045664 regulation of neuron differentiation GO:0048666 neuron development GO:0048813 dendrite morphogenesis GO:0007519 skeletal muscle tissue development GO:0016477 cell migration GO:0007520 myoblast fusion |
InterPro families   | ND |
Orthology group | MCL40554 |
Nucleotide sequence:
ATGGAAGAACTTAAAAAGGACGTCGAGAGCGCCAAGGTGCTGTCGGCGCACAAGAGTTTC
CTCGAGAACGTCACCGACCTGGGCATCCTCAAGAAGAAGGCGATGAGTATAGGCGCCAGC
GAGGAGGCCGCGACCAACCTAGTGGTGAACGCGTCCAAATGA
Protein sequence:
MEELKKDVESAKVLSAHKSFLENVTDLGILKKKAMSIGASEEAATNLVVNASK