Monarch geneset OGS2.0

DPOGS210528
TranscriptDPOGS210528-TA1164 bp
ProteinDPOGS210528-PA387 aa
Genomic positionDPSCF300186 + 293394-295028
RNAseq coverage54x (Rank: top 69%)
Annotation
HeliconiusHMEL0112686e-8340.15% 
BombyxBGIBMGA012630-TA6e-6837.16% 
DrosophilaCG1561-PB2e-2826.61% 
EBI UniRef50UniRef50_Q0PCR81e-6838.08%Ecdysteroid 22-phosphate n=1 Tax=Bombyx mori RepID=Q0PCR8_BOMMO
NCBI RefSeqNP_001038956.12e-6938.08%ecdysteroid 22-kinase [Bombyx mori]
NCBI nr blastpgi|1138659415e-6838.08%ecdysteroid 22-kinase [Bombyx mori]
NCBI nr blastxgi|1138659411e-6438.29%ecdysteroid 22-kinase [Bombyx mori]
Group
Gene OntologyGO:00167728.5e-06transferase activity, transferring phosphorus-containing groups
KEGG pathway 
InterPro domain[35-308] IPR0041195.8e-43Protein of unknown function DUF227
[123-307] IPR0158975.9e-21CHK kinase-like
[123-297] IPR0110098.5e-06Protein kinase-like domain
Orthology groupMCL18552 Lepidoptera specific
Genotypes for resequenced monarchs and outgroup Danaus species

Nucleotide sequence:

>DPOGS210528-TA
ATGGACAAACCAGAACAAACATTACGAGAAACACTTGAAAAAGTTGCGAAAGAATATGGCTATGAAAACTATCATATAATTCAGAAGGCCATTTCAACCGAGGGAGCTAACTACACCACTGTTTTATATCAAGCATCTATAAAAGCTCCAGAGAAGGAGGAACTCAAATTATTCGCGAAAGTCGCTGCTGTTGGAGAAAATATGAGAGCAGTCACGCCTTTAAAAATGTTTGAGACGGAGAGCCTGTTCTATAACAAGTTGAATGAGAAATATAAAGAGTTAGAAGATAAATATGACGTACCCGCAGAACACCGATTCGTAACACCGAAATTTTACGGCGAATCCAAAGAATATTTAAAAGAAACTTTGGTGTTCGAAGATTTAACAGCTCAGGGTTTCACGACACATGACAGATTTGTATCTATAGATTGGGAGTACGCTTCCAAAGGTTTAGAAAATCTTGCGAAATTTCACGCCTTATCATTTGCGTTTTCTGCGTACGACCCAGACGGATTCAAAGAGATGGCTGTTTTGAAAGGTCGCCGTGACGTGGACGCGGCGCTGGCTTACTTTAAGAAGGTCGTAACAAACGCTACCCAAGTGACCAAGGAAGCGAACAGAGAACGTTTTTCCAAATTTATGAATGAATTAATTGATAGTAGAGACATTGACAGATTTTATGGACATCGCACACGGCCTGTTATTATTCACGGTGACTACAGGCCAAGCAATTTAATGCACAGAATTTTAGACCACGGCATGGAGATGGTGACCGTCGACTACCAGACCTTGGAAATGGCGAATCCGATCATTGATATCTTGTTTTTTATATTCGTCGGATCTGATAAGAACTTCCGCGACAGACATTTCCACCAATCCTTAAATCACTACTATGACGAATTATCCAAAGCTCTGAAGAGGTTCAGACTCAACCCTCAGGAAGTGTACGCCAGGGAGGATTTCGACGCAGACTTCAAAGAGATCTTGCCCGTGGGTCTGTTGCTGAGCGTGTTCTGTCTGCTGATAGTGACCGTGCAGAAGGAAGACGTTCCCGTGATGAAGGAGGTCGTCGACATCGAAGACTTCTCCATCGACCCCAACGTGATGTACACCGAGCGACTCAATGACGTCATCGATGACTACATTAACATGGGCGTTATTTAA

Protein sequence:

>DPOGS210528-PA
MDKPEQTLRETLEKVAKEYGYENYHIIQKAISTEGANYTTVLYQASIKAPEKEELKLFAKVAAVGENMRAVTPLKMFETESLFYNKLNEKYKELEDKYDVPAEHRFVTPKFYGESKEYLKETLVFEDLTAQGFTTHDRFVSIDWEYASKGLENLAKFHALSFAFSAYDPDGFKEMAVLKGRRDVDAALAYFKKVVTNATQVTKEANRERFSKFMNELIDSRDIDRFYGHRTRPVIIHGDYRPSNLMHRILDHGMEMVTVDYQTLEMANPIIDILFFIFVGSDKNFRDRHFHQSLNHYYDELSKALKRFRLNPQEVYAREDFDADFKEILPVGLLLSVFCLLIVTVQKEDVPVMKEVVDIEDFSIDPNVMYTERLNDVIDDYINMGVI-