DPOGS213217 | ||
---|---|---|
Transcript | DPOGS213217-TA | 87 bp |
Protein | DPOGS213217-PA | 28 aa |
Genomic position | DPSCF300114 + 463427-464502 | |
RNAseq coverage | 9445x (Rank: top 1%) |
Annotation | ||||
---|---|---|---|---|
Heliconius | HMEL017084 | 8e-07 | 95.83% |   |
Bombyx | BGIBMGA007412-TA | 1e-06 | 95.83% |   |
Drosophila | % |   | ||
EBI UniRef50 | % | |||
NCBI RefSeq | % | |||
NCBI nr blastp | % | |||
NCBI nr blastx | % |
Group | ||||
---|---|---|---|---|
Gene Ontology | GO:0005840 | 9.7e-06 | ribosome | |
GO:0006412 | 9.7e-06 | translation | ||
GO:0005622 | 9.7e-06 | intracellular | ||
GO:0003735 | 9.7e-06 | structural constituent of ribosome | ||
KEGG pathway |   | |||
InterPro domain | [1-24] IPR008195 | 9.7e-06 | Ribosomal protein L34Ae | |
Orthology group |   |
Genotypes for resequenced monarchs and outgroup Danaus species |
---|
>DPOGS213217-TA
ATGGTACAGCGTCTTACATTTAGACGACGTTTGTCGTACAACACCAAGTCGAACCAAAGGAGAATATCTCGACACATAACTTTTTAA
>DPOGS213217-PA
MVQRLTFRRRLSYNTKSNQRRISRHITF-